C. elegans strains and maintenance
C. elegans were maintained at 20°C on standard nematode growth medium (NGM) seeded with OP50 E.coli39. In all experiments, worms were raised at the standard temperature (20°C) until adulthood and then transferred to the temperatures indicated in the corresponding figures (15°C, 20°C, and 25°C). All experiments were performed with adult hermaphroditic worms at the ages indicated in the corresponding figures and figure legends.
Wild type (N2), TQ233 (trpa-1 (ok999) IV, 6× cross with wild-type N2 worms), LC141 (him-8(e1489) IV;cat-4 (e3015) V, 6× crossing with N2), LC35 (cat-4 (ok342) V, 3× crossing with N2), LC81 (cat-4 (tm773) V, 5× crossing with N2), LC143 (pcbd-1(tm5924) I, 4× crossing with N2), LC87 (qdpr-1(tm2337) III, 2× crossing with N2), MT15620 (cat-2 (n4547) II, 6× crossing with N2), MT14984 (tph-1(n4622) II, 6× crossing with N2), LC144 (agmo-1(e3016) III, 6× crossing with N2), LC74 (pah-1 (ok687) II, 5× crossing with N2), MQ887 (isp-1 (qm150) IV, 3× crossing with N2), DA1116 (eat-2(ad1116) II, 2× crossing with N2), DA597 (phm-2(ad597) I, 2× crossing with N2), SJ4100 (zcIs13(hsp-6p::GFP)) V, 3× crossing with N2) and AM141 ( rmIs133(unc-54p::Q40::YFP) X, crossed 5× with N2) were obtained from theCaenorhabditis University of Minnesota Genetics Center (CGC), supported by the NIH Office of Research Infrastructure Programs (P40 OD010440). CF1041 (daf-2(e1370) III) and CF512 (iron-15(b26) II; fem-1(hc17) IV) were provided by C. Kenyon. BJ49 (kcIs6(ifb-2p::ifb-2a::CFP) IV)40 was a gift from RE Leube. AM23 (rmIs298(F25B3.3p::Q19::CFP)) and AM716 (rmIs284(F25B3.3p::Q67::YFP)) the strains were provided by RI Morimoto27. MAH602 ( sqIs61(vha-6p::Q44::YFP + rol-6(su1006))) was donated by Mr. Hansen41.
For tissue-specific RNAi experiments, we used either rde-1– Or side-1-mutant worms in which the wild type rde-1 Or side-1 genes were rescued using tissue-specific promoters, respectively. The WM118 strains (muscle RNAi, rde-1(ne300) V;neIs9(myo-3p::HA::RDE-1+ role-6 (su1006)) )42IG1846 (RNAi epidermis 1, rde-1(ne300)V; frSi21(col-62p::rde-1 3 ‘ UTR) II; frIs7(nlp-29p::GFP +IV)43NR222 (RNAi epidermis 2, rde-1(ne219)V; kzIs9(lin-26p::NLS::GFP+ + role-6 (su1006)) )44MAH677 (neural RNAi,side-1 (qt9) ;sqIs71 (rgef-1p::GFP +rgef-1p::sid-1)45IG1839 (intestinal RNAi 1, rde-1(ne300) V;frSi17(mtl-2p::rde-1 3UTR)II; frIs7 (nlp-29p::GFP+ col-12p::DsRed)IV)43VP303 (intestinal RNAi 2, rde-1(ne219) V; kbIs7(nhx-2p::rde-1 +role-6 (su1006)) )46and DCL569 (germline RNAi,mkcSi13(sun-1p::rde-1::sun-1 3‘ UTR+unc-119(+))II;rde-1(mkc36)V) were provided by the CCG. The RB891 strain (ent-1(ok743)IV) was also obtained from CGC and crossed four times with wild-type N2 worms to generate DVG397. Then, DVG397 was crossed with MAH677 and WM118 to generate DVG399 and DVG400, respectively.
The control strain DVG9 (N2,ocbEx9(myo3p::GFP)) was generated by microinjection of 20 ng μl−1 pPD93_97 (myo-3p::GFP) in the gonads of adult N2 hermaphrodite animals47. To generate DVG348 (N2,ocbEx280(on-5p::cat-4, myo-3p::GFP)), we injected a DNA mixture containing 70 ng µl−1 of the sur5-p::cat-4 plasmid and 5 ng μl−1 pPD93_97 (myo3-p::GFP). Following this method, we generated the DVG349 strains (intestine-specific overexpression: N2, ocbEx281 (gly-19p::cat-4, myo-3p::GFP)), DVG351 (specific overexpression of neurons: N2,ocbEx283 (rgef-1p::cat-4, myo-3p::GFP)), and DVG352 (muscle-specific overexpression: N2, ocbEx284 (myo-3p::cat-4, myo-3p::GFP)). Similarly, we used the neuron-specific RNAi strain (MAH677) to generate DVG377 ( side-1 (qt9) ; sqIs71(rgef-1p::GFP+rgef-1p::sid-1) ;ocbEx301 (myo-3p::cat-4, myo-3p::mCherry)) and the corresponding command DVG378 (side-1 (qt9);sqIs71(rgef-1p::GFP+rgef-1p::sid-1);ocbEx302 (myo3p::mCherry)). To generate DVG389 (trpa-1 (ok999)IV;ocbEx309(myo-3p::GFP)) and DVG390 (trpa-1 (ok999)IV;ocbEx310 (myo-3p::cat-4, myo-3p::GFP)), we injected the gonads of TQ233 worms as indicated above.
To generate DVG373 (rmIs298(F25B3.3p::Q19::CFP);ocbEx297 (myo-3p::cat-4, myo-3p::mCherry) ) and DVG375 (rmIs284(F25B3.3p::Q67::YFP);ocbEx299 (myo-3p::cat-4, myo-3p::mCherry) ), we injected the gonads of AM23 and AM716 worms with a mixture of DNA containing 100 ng μl−1 of the myo3-p::cat-4 plasmid and 5 ng μl−1 of pCFJ104 (myo-3p::mCherry). The corresponding control strains, DVG376 (rmIs298(F25B3.3p::Q19::CFP) ;ocbEx300 (myo-3p::mCherry)) and DVG380 (rmIs284(F25B3.3p::Q67::YFP) ;ocbEx304(myo-3p::mCherry)), were generated by injecting 5 ng μl−1 of plasmid pCFJ104 (myo-3p::mCherry) alone.
The VDL20/PHX10108 strain expressing endogenous CAT-4 tagged with GFP (cat-4 (syb10108)) was generated by SunyBiotech (http://www.sunybiotech.com/) using the following sgRNAs: sg1, CACCACAACATCCTGCATGTTGG; and sg2, CCGTGACGATCCAAAGACTCGCG. Genome editing was confirmed by sequencing ofcat-4gene fused to GFP (primers: 5′-CATTTAGTTCCATTTATGGG-3′ and 5′-TTTGGAGCTCGAGTCGCTTA-3′). From strain VDL20, we generated DVG387 (cat-4::SL2::GFP) by CRISPR–Cas9-mediated insertion48 of an SL2 sequence using the crRNA AAAGGAGAAGAACTTTTCAC, allowing independent translation of CAT-4 and GFP from a single bicistronic pre-mRNA transcribed under the endogenous systemcat-4promoter. Editing was confirmed using the following primers: 5′-CCGGAGTTGCAGTTGTTATTG-3′ and 5′-TCTCGAGAAGCATTGAACACC-3′.
For allC. elegansexperiments, the exact sample sizes are indicated in the corresponding figure legends. No statistical method was used to predetermine the sample size. Sample sizes were selected based on established standards in the field and were similar to or greater than those found sufficient in previous studies using the same procedures (e.g., lifespan, nose contact, chemotaxis, and motility tests).2,10,28,49,50,51,52. Worm populations were synchronized either by allowing young hermaphrodites to lay eggs for 6 hours or by bleaching them.53. For spawning synchronization, young hermaphrodites were randomly selected from maintenance plates. For synchronization by bleaching, pieces of agar containing mixed-instar animals were randomly selected from maintenance plates, and larvae were allowed to grow until sufficient numbers of young hermaphrodites were available for bleaching. After the 6-hour oviposition or blanching period, larvae were reared to adulthood. For lifespan tests, adult worms were randomly selected from the synchronized population and allocated to the different experimental conditions. For all other experiments, adult worms were randomly distributed from single synchronized populations into the different experimental groups. Thus, the assignment of worms to experimental conditions was randomized throughout the study. Samples from different experimental conditions were collected and lysed in random order to minimize potential effects of processing order. Samples and experimental conditions were not blinded. To minimize potential bias and assess reproducibility, key experiments, including phenotypic analyses, were repeated independently by at least two researchers involved in the study.
Metabolomics
Adult worms were collected at the ages indicated in the corresponding figures. Worms were lysed in an extraction solution consisting of 50% LC-MS grade methanol (Thermo Fisher Scientific, 10284580), 30% LC-MS grade acetonitrile (Thermo Fisher Scientific, 10001334), 20% ultrapure water, and 5 μM valine-d8 (CK isotopes, DLM-488), using a volume equivalent to 10 times that of the worm. weight of the pellets. The worm pellet was transferred to a Precellys tube and homogenized using a Precellys Evolution Touch homogenizer (Bertin Technologies). The lysates were then transferred to Eppendorf tubes and incubated for 15 min at 4°C on a shaker at maximum speed. After incubation, samples were centrifuged at maximum speed for 25–40 min and the supernatant was collected.
Worm extracts were normalized by weight for metabolomic analysis of all possible metabolites. Metabolites were separated chromatographically using a Millipore SeQuant ZIC-pHILIC analytical column (5 µm, 2.1 × 150 mm) with a matching 2.1 × 20 mm guard column, both having a particle size of 5 µm. A binary solvent system was used, consisting of 20 mM ammonium carbonate with 0.05% ammonium hydroxide as solvent A and pure acetonitrile as solvent B. Chromatography was carried out at 40 °C with a flow rate of 0.200 ml/min.−1using the following gradient program: 80% solvent B from 0 to 2 min, a linear gradient to 20% solvent B from 2 to 17 min, a rapid return to 80% solvent B from 17 to 17.1 min, and a hold at 80% solvent B from 17.1 to 23 min. The autosampler tray was kept at 4 °C and 5 μl of each sample was injected. Samples were randomized to minimize analytical variability, and pooled quality control samples, prepared by mixing equal volumes of all individual samples, were analyzed regularly to ensure consistency.
Metabolite quantification was performed using a Vanquish Horizon UHPLC system coupled to the Orbitrap Exploris 240 mass spectrometer (Thermo Fisher Scientific) with a heated electrospray ionization (HESI) source. The ionization parameters were set to +3.5 kV (positive mode) and −2.8 kV (negative mode), with an RF lens value of 70, a heated capillary temperature of 320 °C, and an auxiliary gas heating temperature of 280 °C. The sheath gas flow rate was set to 40, the auxiliary gas flow rate was set to 15, and the sweep gas was turned off. MS1 analyzes covered a mass range ofm/z70 to 900, with automatic gain control (AGC) objectives and maximum injection times. Data were acquired in full scan mode with polarity switching at a resolution of 120,000. The AcquireX Deep Scan workflow facilitated the identification of off-target metabolites by iteration…
Gn Health
