UNC13A splicing correction rescues synaptic dysfunction induced by loss of TDP-43

Cell culture (University College London)

Key reagents can be found in Supplementary Table 1. SH-SY5Y (American Type Culture Collection (ATCC)) and SK-N-BE(2) (ATCC) cells with stable doxycycline-inducible short hairpin RNA (shRNA) for TARDBP were described in ref. ⁶ and were maintained in DMEM–F12 with GlutaMAX (Thermo Fisher Scientific) with 10% fetal bovine serum (FBS) (Thermo Fisher Scientific), 1% penicillin–streptomycin (Thermo Fisher Scientific) and split with TrypLE Express (Thermo Fisher Scientific) at 80% confluence. The WTC11 iPS cell line derived from a healthy human participant (GM25256) with stable integration of doxycycline-inducible expression of NGN2 to the AAVS1 locus and stable integration of dCas9-BFP-KRAB at CLYBL locus was a gift from Mr. Ward⁵¹. This iPS cell line is heterozygous for UNC13A Risk SNPs (rs12608932 and rs12973192). Cells were maintained in E8 Flex medium (Thermo Fisher Scientific) in Geltrex-coated plates (Thermo Fisher Scientific) and passaged with Versene (Thermo Fisher Scientific) or Accutase (Thermo Fisher Scientific) solution at 80% confluence. All cell lines were authenticated by short tandem repeat profiling and were routinely tested for mycoplasma contamination, with negative results everywhere. For induction of iPS cells into iNeurons, iPS cells were passaged with Accutase (Thermo Fisher Scientific) and plated in Geltrex-coated plates with induction medium: DMEM–F12 with GlutaMAX (Thermo Fisher Scientific), 1 × N2-Max supplement (R&D Systems), 1 × nonessential amino acids (Thermo Fisher Scientific), 2 μg ml⁻¹ doxycycline hyclate (Sigma-Aldrich), 2 μM XAV939 (Cayman Chemical), 10 μM SB431542 (Cayman Chemical), and 100 nM LDN-193189 (Cayman Chemical)^52.53. The medium was changed daily for 3 days. On the third day, the cells were replated on poly-I-coated with ornithine (10 μg ml⁻¹; Sigma-Aldrich) for RNA and protein experiments or on 50 μg ml⁻¹ poly-d-lysine (PDL) (Gibco; Thermo Fisher Scientific) and 10 μg ml⁻¹ Laminin (Gibco; Thermo Fisher Scientific) (Deckglaser)-coated 18 mm coverslips with primary rat astrocytes for electrophysiology, live imaging, and immunofluorescence experiments. Differentiated neurons were maintained in neuronal medium (synaptic medium) with additional supplements: BrainPhys (StemCell Technologies), with 1 × N2-Max supplement (R&D systems), 1 × N21-Max supplement (R&D systems), 10 ng ml.⁻¹ NT3 (StemCell Technologies), 20 ng ml⁻¹ glial cell line-derived neurotrophic factor (GDNF) and brain-derived neurotrophic factor (BDNF) (Peprotech), 2.5% FBS (Thermo Fisher Scientific), 1 × non-essential amino acids (Thermo Fisher Scientific), 0.2 mg ml⁻¹ cAMP (Sigma-Aldrich), 1 × GlutaMAX (Thermo Fisher Scientific), 1% penicillin-streptomycin (Thermo Fisher Scientific), and 200 nM ascorbic acid (Sigma-Aldrich)⁵⁴. This media was used for all experiments, except for MEA recordings performed without FBS. Half-medium changes were performed twice a week for all cultures, or after recording on MEA cultures.

For preparation of rat astrocytes, primary cortices were dissected from E18 Wistar rat embryos (Charles River Laboratories) and treated with 0.5 mg ml⁻¹ trypsin (Worthington) for 15 min at 37°C. Cortex were washed with Hanks’ balanced salt solution (Thermo Fisher Scientific) and triturated with fire-polished glass Pasteur pipettes of decreasing diameter in DMEM (Thermo Fisher Scientific) + 10% FBS (Gibco; Thermo Fisher Scientific). Cells were collected by centrifugation at 900 rpm for 10 min, resuspended, and passed through a 70-µm cell strainer. Approximately 15–18 million cells were plated in a T-75 flask and cultured in DMEM + 10% FBS + 1% penicillin-streptomycin (Thermo Fisher Scientific). After 2 days, a complete media change was performed to remove antibiotics and the media was then replaced every 3 days. Once reaching confluence, cultures were enriched for astrocytes by shaking at 180 rpm on an orbital shaker for 30 min, after which the medium was removed. Fresh medium was added and agitation was increased to 240 rpm for 6 h, after which the medium was replaced. These steps eliminate microglia and oligodendrocyte precursor cells. Astrocyte-enriched cultures were passaged with 0.25% trypsin–EDTA (Thermo Fisher Scientific) and grown in fresh T-75 flasks for 12–14 days, with a change of medium every 2–3 days, until confluent. Astrocytes were then passaged and stored in liquid nitrogen or plated on 50 μg ml.⁻¹ PDL (Gibco; Thermo Fisher Scientific) and 10 μg ml⁻¹ 18 mm coverslips coated with laminin (Gibco; Thermo Fisher Scientific) (Deckglaser) for culture with iNeurons.

Cell culture (Leibniz-FMP-Berlin)

The human iPS cell line GM25256, heterozygous for UNC13A Risk SNPs (rs12608932 and rs12973192) (Coriell Institute for Medical Research) were maintained in mTeSR1 stem cell culture media on Matrigel-coated plates (StemCell Technologies, 85850; Corning, 354277). Human iPS cells were fed daily and divided every 4–5 days. Differentiation of iPS cells into motor neurons (iMNs) was achieved using three-dimensional developmental pathways for 14 days (ref. ^7.55). On day 14, neuronal spheroids were dissociated, counted, and frozen using 70% KnockOut serum replacement (Gibco; Thermo Fisher Scientific, 10828010), 20% 1 M trehalose (Thermo Fisher Scientific, 182550250), and 10% DMSO (Sigma-Aldrich, D2650). Neurons were thawed and plated on PDL–laminin-coated coverslips or directly on PDL-coated coverslips on which mouse astrocytes were plated.²⁵and maintained in medium containing Neurobasal medium (Gibco; Thermo Fisher Scientific, 12348017) supplemented with 1 × N-2 supplement (Gibco; Thermo Fisher Scientific, 17502001), 1 × B-27 supplement (Gibco; Thermo Fisher Scientific, A1486701), 1 × penicillin-streptomycin (Gibco; Thermo Fisher Scientific, 15140-122), 20 µM I-ascorbic acid (Sigma-Aldrich, A4403-100MG), 1% KnockOut serum replacement (Gibco; Thermo Fisher Scientific, 10828010), 5 µM ROCK inhibitor Y-27632 (StemCell Technologies, 72304), 10 ng ml⁻¹ GDNF (R&D Systems, 212-GD-050), 10 ng ml⁻¹ CNTF (R&D Systems, 257-NT-050) and 20 ng ml⁻¹ BDNF (R&D Systems, 11166-BD-050) for the first 2 days. After 2 days, half of the medium was exchanged with neuronal maintenance medium without the ROCK inhibitor and supplemented with 5 µM DAPT (Sigma-Aldrich, D5942) and 10 ng ml⁻¹ BDNF. Five days later, iMNs were fed neuronal maintenance medium without ROCK inhibitor or DAPT. iMNs were supplemented with fresh medium every 7 days.

Spinal iMNs release the neurotransmitter acetylcholine, but do not express postsynaptic nicotinic receptors. As such, iMN cultures express synaptic markers, but the cells are not synaptically connected. To record synaptic transmission properties in these neurons, we expressed green fluorescent protein (GFP)-tagged vesicular glutamate transporter (VGlut1) in iMNs 1 week before electrophysiological recordings, based on previous observations that its expression can confer glutamate release in inhibitory neurons.⁵⁶. Complementary DNA (cDNA) encoding rat VGlut1 tagged with enhanced GFP (EGFP) at the carboxy terminus was used to prepare lentiviral particles (Viral Core Facility at Charité – Universitätsmedizin Berlin). The FUGW vector⁵⁷in which the ubiquitin promoter was exchanged with the human synapsin 1 promoter, was used according to a previously published study.⁵⁷modified protocol⁵⁸using helper plasmids⁵⁹ (Addgene, 8454 and 8455).

Lentivirus production for CRISPRi knockdown

The sgRNA vector pU6-sgRNA EF1Alpha-puro-T2A-BFP (Addgene 60955) was used to express the following sgRNAs:

sgCTRL, GTCCACCCTTATCTAGGCTA

sgTARDBPGGGAAGTCAGCCGTGAGACC

sgUNC13AGGAACCAAGATGGCCGGTGG

The sgRNA transfer plasmid along with the packaging (pCMVΔ8.91) and VSVG envelope (pMD.G) plasmids were transfected into human embryonic kidney 293T (HEK293T) cells (Horizon Discovery) with TransIT-293 (Mirus). Medium was collected on days 2 and 3 after transfection, combined and concentrated 1:10 with the Lenti-X concentrator (Takara Bio).

HaloTag Edition TARDBP

iPS cells were electroporated with 10 µg of HaloTag-TARDBP homology-directed repair model (gift from M. Ward, National Institutes of Health (NIH)), 500 pmol of Cas12 CRISPR-RNA (crRNA) (GGAAAAGTAAAAGATGTCTGAAT, Integrated DNA Technologies), and 20 μg of recombinant Cas12 (Integrated DNA Technologies) using the P3 Primary Cell 4D-Nucleofector kit (Lonza) and 4D-Nucleofector Unit (Lonza) using the CA-137 program. After electroporation, iPS cells were plated in E8 Flex Media supplemented with 1 × RevitaCell (Thermo Fisher Scientific) and 1 × Alt-R HDR Enhancer V2 (Integrated DNA Technologies) for 24 h and then expanded in E8 Flex Media. Cells were labeled with HaloTag-TMR ligand (Promega) and positive clones were selected for PCR genotyping.

UNC13A cryptic deletion of exon 20-21

The sgRNAs were designed to target 45 bp upstream of the acceptor splice site of the long cryptic exon (GGAAAAGTAAAAGATGTCTGAAT) and 10 bp downstream of the donor splice site (GAGATGGGTGAGTACATGGA). Sense and antisense bridging oligonucleotides 5′-AAAGTCCAGATTCAGGG TCACCTCCTCTGGGAAGCCCACC TTGGCCTCCBGGATGGATAGATGGATGAGTTGGTGGGTAGATTCGTGGCTAGATGGATGA-3′ and 5′-TCATCCATCTAGCCACGAATCTACCCACCAACTCATCCATCTATCCATCDTGGAGGCCAAGGTGGGCTTCCCAGAGGAGGTGACCCTGAATCTGGACTTT-3′, which includes the degenerate bases B (C, G, or T) and D (A, G, or T), were designed as homology-directed repair templates. The WTC11 iPS cell line (GM25256) and SH-SY5Y were electroporated with 250 pmol of each Cas9 sgRNA (Integrated DNA Technologies) along with 20 μg of recombinant Cas9 (Integrated DNA Technologies) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4D-Nucleofector kit (Lonza) using…